migrate-n

Estimates effective population sizes and past migration rates

Introduction

Migrate-n is a bioinformatics and population genetics program which is designed to model population sizes, gene flow between populations and past migration rates.

Using Migrate-n on RCC Resources

Migrate-n does not require the use of a module.

Serial Example

To run this program in serial, first make a folder in your home directory and make a file named `infile`.

mkdir ~/migrate-n
touch ~/migrate-n/infile

Now, copy this example sequence data from the documentation into `infile`:

2 2 Make believe data set using simulated data (2 loci)
50 46
3 3   pop1
eis       ACACCCAACACGGCCCGCGGACAGGGGCTCGAGGGATCACTGACTGGCAC
zwo       ACACAAAACACGGCCCGCGGACAGGGGCTCGAGGGGTCACTGAGTGGCAC
drue      ATACCCAGCACGGCCGGCGGACAGGGGCTCGAGGGAGCACTGAGTGGAAC
eis       ACGCGGCGCGCGAACGAAGACCAAATCTTCTTGATCCCCAAGTGTC
zwo       ACGCGGCGCGAGAACGAAGACCAAATCTTCTTGATCCCCAAGTGTC
drue      ACGCGGCGCGAGAACGAAGACCAAATCTTCTTGATCCCCAAGTGTC
2    pop2
vier      CAGCGCGCGTATCGCCCCATGTGGTTCGGCCAAAGAATGGTAGAGCGGAG
fuef      CAGCGCGAGTCTCGCCCCATGGGGTTAGGCCAAATAATGTTAGAGCGGCA
vier      TCGACTAGATCTGCAGCACATACGAGGGTCATGCGTCCCAGATGTG
fuefLoc2  TCGACTAGATATGCAGCAAATACGAGGGGCATGCGTCCCAGATGTG

While in the `migrate-n` directory, execute the program using `migrate-n`.

cd ~/migrate-n
migrate-n

A menu will appear, which can be ignored for the purposes of this example. Simply type Y and allow the program to run. The above example will not yield any useful results, but will complete.

Parallel Example

Migrate is available with both gnu-openmpi and gnu-mvapich2. Load the desired module before using the package. Running in parallel is identical to running in serial, but instead using `srun -n n migrate-n-mpi` instead of `migrate-n`. The design of this program requires one director node in addition to worker nodes, so for a 4 node job one would require n=5 total nodes.