Migrate-n

Software Category
Version
3.6.11, 4.4.0

Migrate-n

Migrate-n is a bioinformatics and population genetics program which is designed to model population sizes, gene flow between populations, and past migration rates.

Using Migrate-n on RCC Resources

Migrate-n requires the gnu module to be loaded. Note that there are two versions of the program. These can be called from the command line using the following commands:

# Load the GNU module (for all versions)
module load gnu

# Load the OpenMPI module (if using parallel Migrate)
module load openmpi

# Version 3.6.11
migrate-n        # Serial
migrate-n-mpi    # Parallel

# Version 4.4.0
migrate-n-4        # Serial
migrate-n-4-mpi    # Parallel

Serially Running Migrate-n

To run Migrate-n in serial, first make a folder in your home directory and make a file named infile.

mkdir ~/migrate-n
touch ~/migrate-n/infile

Now, copy this example sequence data from the official documentation into infile:

2 2 Make believe data set using simulated data (2 loci)
50 46
3 3   pop1
eis       ACACCCAACACGGCCCGCGGACAGGGGCTCGAGGGATCACTGACTGGCAC
zwo       ACACAAAACACGGCCCGCGGACAGGGGCTCGAGGGGTCACTGAGTGGCAC
drue      ATACCCAGCACGGCCGGCGGACAGGGGCTCGAGGGAGCACTGAGTGGAAC
eis       ACGCGGCGCGCGAACGAAGACCAAATCTTCTTGATCCCCAAGTGTC
zwo       ACGCGGCGCGAGAACGAAGACCAAATCTTCTTGATCCCCAAGTGTC
drue      ACGCGGCGCGAGAACGAAGACCAAATCTTCTTGATCCCCAAGTGTC
2    pop2
vier      CAGCGCGCGTATCGCCCCATGTGGTTCGGCCAAAGAATGGTAGAGCGGAG
fuef      CAGCGCGAGTCTCGCCCCATGGGGTTAGGCCAAATAATGTTAGAGCGGCA
vier      TCGACTAGATCTGCAGCACATACGAGGGTCATGCGTCCCAGATGTG
fuefLoc2  TCGACTAGATATGCAGCAAATACGAGGGGCATGCGTCCCAGATGTG

Navigate to the migrate-n folder and then execute the program using the command migrate-n.

cd ~/migrate-n
migrate-n

A menu will appear, which can be ignored for the purposes of this example. Simply type Y and allow the program to run. The above example will not yield any useful results, but will complete.

Running Migrate-n in Parallel

Migrate is available with both the gnu-openmpi and gnu-mvapich2 modules. Load the desired module before using the package. Running in parallel is identical to running in serial. To run in parallel, use the command srun -n n migrate-n-mpi instead of migrate-n. The design of this program requires one director node in addition to worker nodes, so for a 4 node job, you need n=5 total nodes.

For detailed usage information about Migrate-n, refer to the official documentation